INTRODUCTION
Echinococcus granulosus is an endoparasitic flatworm that is the causative agent of cystic hydatid disease in intermediate hosts (wild and domestic herbivores), which is one of the most important and widespread zoonoses (Thompson and Lymbery, 1995; McManus et al., 2003).
To date, molecular studies using mainly mtDNA sequences [cytochrome oxidase subunit 1 (CO1) and NADH dehydrogenase 1 (NADH1) genes] have identified ten distinct genotypes (G1-G10) within E. granulosus (Bowles et al., 1992; Scott et al., 1997; Lavikainen et al., 2003). This categorization follows very closely the patterns of strain variation emerging from biological and epidemiological traits (Thompson and McManus, 2002). According to Thompson and Lymbery (1988), a strain is a variant that differs statistically from other groups of the same species in gene frequencies and in one or more traits of actual or potential significance to the epidemiology and control of echinococcosis.
Several techniques using molecular markers such as restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA-polymerase chain reaction (PCR) and single-strand conformation polymorphism (SSCP-PCR) have been used in order to show the high degree of differentiation in the genus Echinococcus (Eckert and Thompson, 1997; Thompson and McManus, 2001). However, it has been shown that genetic variability within strains is present mainly in the E. granulosus G1 genotype or sheep strain (Haag et al., 1999; Kamenetzky et al., 2002).
The U1 snRNA is involved in RNA splicing. A study in E. multilocularis demonstrated that the U1 snRNA gene is more than 50 times tandemly repeated in the tapeworm genome, and that all copies are localized in one cluster. The gene repeat unit is 1,300 bp long and consists of a transcribed region of 156 bp and spacers in which microsatellites of three, four and five nucleotides are found (Bretagne et al., 1991).
Bretagne et al. (1996) analyzed polymorphism of the pentanucleotide microsatellite repeat number by examining patterns of amplification peaks of that sequence for E. multilocularis, which showed agreement with the geographical distribution of the samples. Besides, a further evaluation for E. granulosus of this microsatellite characterized it as a polymorphic molecular marker to genotype strains of E. granulosus in agreement with CO1 sequence analysis (Bart et al., 2004).
Amplification of the pentanucleotide microsatellite in the U1 snRNA gene complex could allow heteroduplex formation among the paralogous sequences, which differ in number and sequences of repetitive units. Heteroduplex DNA has different mobility in polyacrylamide gels due to the single-stranded loops within the heteroduplexes and can be visualized as additional bands in addition to the homoduplex fragments. The greater the heterogeneity among U1 snRNA microsatellite sequences, the greater the number of expected heteroduplex bands. It could work as an alternative to make good use of U1 snRNA microsatellites as potential molecular markers. To our knowledge, no attempts to analyze repeated loci by heteroduplex formation have been made to date.
With the aim of verifying the applicability of heteroduplex pattern analysis to a multiple repeated sequence (the pentanucleotide microsatellite in the internal spacer of the E. granulosus U1 snRNA gene complex), we isolated and characterized this sequence and studied the heteroduplex band patterns of PCR amplification products for four human infective E. granulosus strains: the sheep (G1), Tasmanian sheep (G2), cattle (G5), and camel (G6) strains, in order to detect polymorphism among these strains and within isolates of the same strain.
MATERIAL AND METHODS
Echinococcus granulosus total DNA extraction
Total DNA was extracted from protoscoleces of single hydatid cysts as described earlier (McManus et al., 1985), and the strain determination was performed by sequencing of mitochondrial COI gene (Kamenetzky et al., 2002) or by SSCP-PCR of six different DNA segments (Haag et al., 1999).
Isolation of a U1 snRNA gene segment containing a pentameric microsatellite
A forward primer designed by Bretagne et al. (1996) for E. multilocularis U1 snRNA gene flanking the pentanucleotidic repeat and a reverse primer designed in this study were used to amplify the pentameric microsatellite from E. granulosus (sheep strain).
PCR was carried out in a 50-µL reaction volume containing 20 ng E. granulosus total DNA, 2.5 units Taq DNA polymerase (Cenbiot), 100 µM of each dNTP, 10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, and 20 pmol of each primer (U1 snRNA F - 5’ATTGTCGTTGCCAT CTCTCC3’ and U1 snRNA R - 5’GCTCTCCATCACCACACATC3’).
The samples were subjected to 20 cycles consisting of 1 min denaturation at 94°C, 1 min annealing at 50°C and 1 min extension at 72°C with a touchdown of 1°C at every cycle, followed by 20 more cycles at an annealing temperature of 40°C and a final 5 min extension at 72°C.
The PCR product was used as a probe in the Southern experiment and also cloned for sequencing.
Southern hybridization
Total DNA obtained from protoscoleces of a single hydatid cyst was completely digested with HindIII, EcoRI, RsaI, TaqI, or AluI, electrophoresed on 0.8% agarose gels, transferred to nylon membranes (Hybond N+, Amershan-Pharmacia) and hybridized overnight at 60°C using 100 ng of a 32P-labelled U1 snRNA probe according to standard protocols (Sambrook and Russel, 2001). The filter was washed for 20 min with 5X, 2X, 1X, and 0.2X SSC/0.1% SDS at 50°C.
Cloning of PCR products and sequencing
Amplified products were cloned into the pGEM-T Easy Vector (Promega), according to the manufacturer’s instructions. Clones were sequenced using “Thermo Sequenase Radiolabeled Terminator Cycle Sequencing Kit” (USB) and the universal primers T7 and SP6.
U1 snRNA microsatellite analysis from different isolates
DNA samples from 45 E. granulosus isolates were used: four of camel strain, six of cattle strain, five of Tasmanian sheep strain, and 30 of sheep strain.
PCR conditions were the same as those described above, except for the cycling program. The samples were subjected to 30 cycles of 1 min at 94°C, 1 min at 55°C, 1 min at 72°C, and then 7 min at 72°C for final extension.
The cloned U1 snRNA sequence was used as the PCR positive control. Negative control was carried out without DNA.
Prior to electrophoresis, amplified DNA samples were denatured at 95°C for 5 min and slowly cooled at room temperature for 1 h to allow heteroduplex formation. Products were analyzed by electrophoresis on 6% polyacrylamide gels stained with AgNO3.
Statistical analysis
For the cluster analyses, the heteroduplex DNA bands were assigned 0 or 1, depending on the absence or presence, respectively, of each band in the isolates of the analyzed strains. The numerical analysis of heteroduplex results was performed using the NTSYSpc program (Rohlf, 1998). The Jaccard coefficient was used to obtain a similarity matrix, and the SAHN (sequential, agglomerative, hierarchical, and nested clustering) method (Sneath and Sokal, 1973) was applied to obtain the corresponding dendrogram. A cophenetic value matrix was produced by COPH and used by the MXCOMP program to measure the goodness of fit of a cluster analysis to the similarity matrix produced by SAHN.
RESULTS
Detection and isolation of U1 snRNA microsatellite in the E. granulosus genome
Primers from E. multilocularis U1 snRNA sequence used to isolate the microsatellite of E. granulosus genomic DNA amplified a nearly 260-bp segment. The hybridization of the U1 snRNA probe to digested DNA generated a pattern of single (HindIII and EcoRI) or multiple (RsaI, TaqI and AluI) bands (Figure 1).

Cloning of PCR products
Six different clones containing the microsatellite sequence and its flanking regions were obtained, but each one different from the others and showing identity (91% for clone U1 snRNA-1 and 92% for the remainders) to the E. multilocularis U1 snRNA previously described sequence (Bretagne et al., 1996). Cloned products varied in repeat unit copy number as well as in the sequence of the tandemly repeated unit within the array. Two clones showed imperfect microsatellites while one showed a complex repeat with the main array (GACGA). Two sequences showed compound microsatellites (GACGA)(GCGAG) and one sequence showed another compound microsatellite (GACGA)(GGCGA) (see Table 1).

Heteroduplex analysis of U1 snRNA microsatellite amplification products in different E. granulosus isolates
Analysis of the PCR products by polyacrylamide gel electrophoresis after renaturation showed several bands of different mobilities between 200 and 400 bp, corresponding to heteroduplex DNA. The 260-bp fragment, which was more intensely stained for some samples, probably corresponds to homoduplex DNA (Figure 2).

The four analyzed isolates of camel strain showed the same band migration pattern, called c (Figure 2 and Table 2).
The cattle strain had two very similar heteroduplex DNA migration pattern (Figure 3) among the six isolates analyzed. The cattle strain pattern is easily distinguishable from the others.
Sheep strain samples showed nine different heteroduplex DNA band patterns, three of which (o1, o3 and o6) were shared with Tasmanian sheep isolates (Table 2 and Figure 3).
DNA fragments amplified in independent experiments by PCR, using the same DNA sample and conditions, showed exactly the same heteroduplex patterns, indicating that the patterns are reproducible for each isolate (data not shown).
The statistical analysis of the dendrogram and the similarity-dissimilarity matrix showed the early separation of camel, cattle and sheep strains. The camel pattern was more closely related to cattle than sheep strain patterns. The genetic distance of pattern o8 to the other sheep strain patterns was as great as that between camel and cattle patterns. The other sheep and Tasmanian sheep patterns displayed a close relationship (Figure 3).

DISCUSSION
The similarity of the U1 snRNA gene between E. multilocularis and E. granulosus was demonstrated by sequence analysis showing 91-92% identity within a segment of a 1300-bp sequence previously described in E. multilocularis (Bretagne et al., 1991). Besides, Southern blot analysis showed the same band pattern of the E. multilocularis U1 snRNA gene sequence, except for RsaI which showed seven hybridized fragments instead of four as shown for E. multilocularis.
In the study of U1 snRNA pentanucleotide microsatellite of E. multilocularis isolates from Europe, Japan and North America, Bretagne et al. (1996) found three electrophoretic profiles, which were in agreement with geographic region. The authors also showed through PCR cloning of each profile that differences among peaks were due to the variation in the number of repeated units as well as the sequences of the arrays.
In the present study, a great variability in U1 snRNA pentanucleotide microsatellites was also evident for E. granulosus. The most common array (GACGA)n(GGCGA)n was the same as that sequenced by Bart et al. (2004) for all their samples. However, our clones were shown to be more polymorphic due to the presence of other motifs (Table 1).
As previously demonstrated (Bartholomei-Santos et al., 2003), there is no polymorphism in a microsatellite locus among protoscoleces that reproduce asexually within a single hydatid cyst, so that protoscoleces from one cyst can be pooled and analyzed as one isolate. Thus, the different U1 snRNA cloned sequences and the amplification of DNA segments with different sizes cannot be attributed to the variation among protoscoleces from the same cyst.
Analysis of the heteroduplex migration patterns in several isolates demonstrated genetic polymorphism among E. granulosus strains. Camel strain monomorphism had already been described in a previous study using a microsatellite (Bartholomei-Santos et al., 2003) with the same samples as in the present study. We have found the same U1 snRNA pattern among four isolates. Besides, the camel strain pattern showed less heteroduplex bands than did the other strains analyzed (Figure 2), which could be interpreted as a greater homogeneity in the several paralogous sequences.
The cattle strain showed two similar patterns. Several studies have found the cattle strain to be monomorphic (Haag et al., 1998; van Herwerden et al., 2000; Kamenetzky et al., 2002; Bartholomei-Santos et al., 2003); thus, the presence of two patterns in only six isolates analyzed, even with slight differences, is an interesting finding.
The greatest diversity of heteroduplex DNA patterns formed by U1 snRNA microsatellite amplification was found in the sheep strain which showed nine different patterns, highlighting sheep intrastrain variability. This finding could be due to the greater number of sheep strain isolates analyzed (30) compared to the four camel and the six cattle strain isolates which were shown to be less polymorphic.
However, these results are in agreement with previous studies, in which the sheep strain was the most polymorphic among the strains analyzed by SSCP-PCR of nuclear and mitochondrial genes (Haag et al., 1999; Kamenetzky et al., 2002) and by a dinucleotide microsatellite locus (Egmsca1) analysis (Bartholomei-Santos et al., 2003). Moreover, microsatellite alleles of an Egmsca1 locus were shared between sheep and Tasmanian sheep strains. The proximity of these two strains was already described in parsimonious trees built from mitochondrial data (Bowles et al., 1995).
Differences regarding morphology, prepatency period and allozyme frequencies (Kumaratilake et al., 1983; Lymbery and Thompson, 1988; Thompson and Lymbery, 1988) support the establishment of Tasmanian sheep as a distinct strain from the common sheep strain. A molecular approach based on comparison of mitochondrial DNA sequences demonstrated that only 3 of the 366 nucleotide sites examined in the Tasmanian sheep strain sample (G2) differ from the standard sheep strain sequence (G1) (Bowles et al., 1992). According to our results, it is not possible to differentiate Tasmanian sheep from sheep strain samples through heteroduplex pattern comparison, just as it was not possible by conventional RFLP (Hope et al., 1991), PCR/RFLP technique (Bowles and MacManus, 1993) and the microsatellite locus Egmsca1 analysis (Bartholomei-Santos et al., 2003), which were able to identify other strains. Coincidentally, in a recent study (Obwaller et al., 2004) it was suggested that differentiation between sheep and Tasmanian sheep strains using CO1 and NADH1 mitochondrial genes is questionable or unreliable.
Heteroduplex pattern analysis of U1 snRNA microsatellite provided good information about genetic polymorphism among and within E. granulosus strains. Moreover, this approach can be used in strain genotyping, at least for the strains studied in the present work. In addition, heteroduplex analysis of other microsatellite loci as EMms1 and EMms2 (Nakao et al., 2003) may be evaluated as a method for conducting population genetic studies in E. granulosus.
ACKNOWLEDGMENTS
We would like to thank Centro Brasileiro Argentino de Biotecnologia (CBAB/CABBIO) and CONICET for financial support.
REFERENCES
Bart JM, Bardonnet K, Elfegoun MC, Dumon H, et al. (2004). Echinococcus granulosus strain typing in North Africa: comparison of eight nuclear and mitochondrial DNA fragments. Parasitology 128: 229-234.
Bartholomei-Santos ML, Heinzelmann LS, Oliveira RP, Chemale G, et al. (2003). Isolation and characterization of microsatellites from the tapeworm Echinococcus granulosus. Parasitology 126: 599-605.
Bowles J and McManus DP (1993). Rapid discrimination of Echinococcus species and strains using a PCR-based RFLP method. Mol. Biochem. Parasitol. 57: 231-239.
Bowles J, Blair D and McManus DP (1992). Genetic variants within the genus Echinococcus identified by mitochondrial DNA sequencing. Mol. Biochem. Parasitol. 54: 165-174.
Bowles J, Blair D and McManus DP (1995). A molecular phylogeny of the genus Echinococcus. Parasitology 110: 317-328.
Bretagne S, Robert S, Vidaud D, Goossens M, et al. (1991). Structure of the Echinococcus multilocularis U1 snRNA gene repeat. Mol. Biochem. Parasitol. 46: 285-292.
Bretagne S, Assouline B, Vidaud D, Houin R, et al. (1996). Echinococcus multilocularis: microsatellite polymorphism in U1 snRNA genes. Exp. Parasitol. 82: 324-328.
Eckert J and Thompson RCA (1997). Intraspecific variation of Echinococcus granulosus and related species with emphasis on their infectivity to humans. Acta Trop. 64: 19-34.
Haag KL, Araujo AM, Gottstein B and Zaha A (1998). Selection, recombination and history in a parasitic flatworm (Echinococcus) inferred from nucleotide sequences. Mem. Inst. Oswaldo Cruz 93: 695-702.
Haag KL, Araujo AM, Gottstein B, Siles-Lucas M, et al. (1999). Breeding systems in Echinococcus granulosus (Cestoda; Taeniidae): selfing or outcrossing? Parasitology 118: 63-71.
Hope M, Bowles J and McManus DP (1991). A reconsideration of the Echinococcus granulosus strain situation in Australia following RFLP analysis of cystic material. Int. J. Parasitol. 21: 471-475.
Kamenetzky L, Gutierrez AM, Canova SG and Rosenzvit MC (2002). Several strains of Echinococcus granulosus infect livestock and humans in Argentina. Infec. Genet. Evol. 2: 129-136.
Kumaratilake LM, Thompson RC and Dunsmore JD (1983). Comparative strobilar development of Echinococcus granulosus of sheep origin from different geographical areas of Australia in vivo and in vitro. Int. J. Parasitol. 13: 151-156.
Lavikainen A, Lehtinen MJ, Meri T, Hirvela-Koski V, et al. (2003). Molecular genetic characterization of the fennoscandian cervid strain, a new genotypic group (G10) of Echinococcus granulosus. Parasitology 127: 207-215.
Lymbery AJ and Thompson RC (1988). Electrophoretic analysis of genetic variation in Echinococcus granulosus from domestic hosts in Australia. Int. J. Parasitol. 18: 803-811.
McManus DP, Knight M and Simpson AG (1985). Isolation and characterization of nucleic acids from the hydatid organisms, Echinococcus spp. (Cestoda). Mol. Biochem. Parasitol. 16: 251-266.
McManus DP, Zhang W, Li J and Bartley PB (2003). Echinococcosis. Lancet 362: 1295-1304.
Nakao M, Sako Y and Ito A (2003). Isolation of polymorphic microsatellite loci from the tapeworm Echinococcus multilocularis. Infec. Genet. Evol. 3: 159-163.
Obwaller A, Schneider F, Walochnik F, Gollackner B, et al. (2004). Echinococcus granulosus strain differentiation based on sequence heterogeneity in mitochondrial genes of cytochrome c oxidase-1 and NADH dehydrogenase-1. Parasitology 128: 569-575.
Rohlf FJ (1998). NTSYS-pc: numerical taxonomy and multivariate analysis system. Release 2.0g. Exter Software, Setauket, New York, NY, USA.
Sambrook J and Russell DW (2001). Molecular cloning: a laboratory manual. 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, NY, USA.
Scott JC, Stefaniak J, Pawlowski ZS and McManus DP (1997). Molecular genetics analysis of human cystic hydatid cases from Poland: identification of a new genotypic group (G9) of Echinococcus granulosus. Parasitology 114: 37-43.
Sneath PHA and Sokal RR (1973). Numerical taxonomy. W.H. Freeman and Company. San Franscico, CA, USA.
Thompson RCA and Lymbery AJ (1988). The nature, extend and significance of variation within the genus Echinococcus. Adv. Parasitol. 27: 209-258.
Thompson RCA and Lymbery AJ (1995). Echinococcus and hydatid disease. C.A.B. International Mycological Institute, Wallingford, Oxon, UK.
Thompson RCA and McManus DP (2001). Aetiology: parasites and life-cycles. In: Manual on Echinococcosis in humans and animals: a public health problem of global concern (Eckert J, Gemmell MA, Meslin FX and Pawlowski ZS, eds.). WHO/OIE, Paris, France, 1-19.
Thompson RCA and McManus DP (2002). Towards a taxonomic revision of the genus Echinococcus. Trends Parasitol. 18: 452-457.
van Herwerden L, Gasser RB and Blair D (2000). ITS-1 ribosomal DNA sequence variants are maintained in different species and strains of Echinococcus. Int. J. Parasitol. 30: 157-169.