ABSTRACT. Chronic myeloid leukemia (CML) originates from the hematopoietic stem cell and is characterized by the reciprocal translocation t(9;22)(q34;q11), which results in the BCR-ABL fusion gene on chromosome 22q-, also known as the Philadelphia chromosome. This chimeric gene codes for a cytoplasmic protein with constitutive tyrosine-kinase activity, responsible for cellular transformation and leukemogenesis in CML. The aim of this observational cohort study was to discriminate and quantify BCR-ABL transcripts in the peripheral blood of patients with CML who were treated with imatinib mesylate (Glivec^®, Novartis). Twenty-two patients were followed for six months during treatment. Quantitative real time polymerase chain reaction was performed before treatment and after 3 and 6 months from treatment initiation. As compared with the third month, there was a significant decrease in BCR-ABL expression in the sixth month of treatment (P = 0.0002). At the sixth month, there was a significant difference in the levels of the two major transcripts of BCR-ABL, B2A2 and B3A2 (P = 0.0347), indicating that B2A2 may be more sensitive to imatinib. The results of our study indicate that imatinib is able to modify the natural history of CML, and raise the hypothesis that patients who express the B2A2 transcript may have a better prognosis.

Key words: Chronic myeloid leukemia, Imatinib mesylate, RQ-PCR

INTRODUCTION

Chronic myeloid leukemia (CML) is classified by the World Health Organization (WHO) as a chronic myeloproliferative disease (CMPD), and occupies the first place in the first chapter of the WHO classification. There are some reasons why CML is the first disease in this classification. CML was the first hematological disease to be named leukemia, the first malignancy associated with a cytogenetic marker (the Philadelphia chromosome), and the first disease in which a fusion gene (BCR-ABL) was found in a chromosomal translocation. This latter gene gives rise to a fusion protein that plays a fundamental role in the pathogenesis of CML (Jaffe et al., 2001). CML has become the first disease to be successfully treated with a novel therapeutic agent, imatinib mesylate (Glivec^®, Novartis). Imatinib was designed to inhibit the growth of BCR-ABL-positive cells (Druker et al., 1999, 2001). Although imatinib is highly efficient, bone marrow transplantation is currently the only known curative treatment for CML (Deininger et al., 2000).

Patients undergoing treatment for CML need to be monitored for response. Both hematological and cytogenetic responses have been used in the assessment of imatinib efficacy (Talpaz et al., 2002). Classic cytogenetic analysis is a good predictor of the outcome of imatinib-based therapy in CML, but it is laborious and has limited sensitivity. A good monitoring test should be sensitive, easy to perform, and able to be done in peripheral blood.

Accurate techniques to detect the BCR-ABL transcript in blood have been developed, and have allowed the diagnosis and monitoring of minimal residual disease in CML patients (Meissner et al., 1999; Hughes and Branford, 2003). Recently, many authors have described methods to measure BCR-ABL expression by competitive PCR (Campanini et al., 2001) and quantitative real time polymerase chain reaction (RQ-PCR) (Saffroy et al., 2000; Barbany et al., 2000; Amabile et al., 2001). The first report on the use of RQ-PCR for monitoring CML patients undergoing treatment with imatinib was published by Stentoft et al. (2001). These authors validated the use of RQ-PCR in the evaluation of treatment responses in this setting.

Although the different types of BCR-ABL transcripts (B2A2 and B3A2) can be detected and quantified (Amabile et al., 2001), the clinical value of transcript discrimination is controversial and has been questioned. Some authors have found that transcript types have no prognostic value (Meissner et al., 1999; Stentoft et al., 2001), and others have associated the B3A2 transcript with increased platelet counts (Perego et al., 2000; Rosas-Cabral et al., 2003).

In the current study, we used RQ-PCR to detect and quantify B2A2 and B3A2 transcripts in CML patients during treatment with imatinib, and we were able to demonstrate their differential expression during treatment.

MATERIAL AND METHODS

Patients

Twenty-two CML patients from the Ofir Loiola Hospital in the city of Belém, Brazil, were diagnosed by clinical and hematological criteria and had disease confirmation by reverse transcriptase (RT)-PCR for BCR-ABL. Of these 22 patients, 15 (68%) were in chronic phase, five (23%) in accelerated phase and two (9%) in blastic phase. Eleven patients (50%) were female, and 11 (50%) were male. The mean age was 44.5 ± 11.67 years (range, 23 to 70). We defined two age groups: patients with 40 years or less (45% of the cases), and patients older than 40 years (55%). The mean period between diagnosis and inclusion in the study was 3.5 ± 2.1 years (range, 6 months to 7.8 years). All patients had been previously treated with hydroxyurea and/or interferon-alpha. According to the recommendations by the Brazilian Health Ministry, all patients were treated with single-agent imatinib, after verification of interferon intolerance and/or failure; patients in chronic phase received 400 mg/day, and patients in accelerated or blastic phases were treated with 600 mg/day.

Study design

Peripheral blood samples were obtained at three different time points: day zero (DZ) before the treatment and at 3 (3M) and 6 months (6M) after the initiation of treatment.

RNA isolation

Total RNA was isolated from 100 µL of peripheral blood leukocytes with guanidinium isothiocyanate (Trizol LS^TM - Invitrogen), according to the protocol provided by the manufacturer.

Polymerase chain reaction

RQ-PCR was performed in the ABI Prism 7000 (Applied Biosystems) thermocycler by the RT-PCR TaqMan^® system (Applied Biosystems), according to the protocol provided by the manufacturer. Five microliters RNA was added to the reactions, which were incubated at 50°C for 2 min, 60°C for 30 min and 95°C for 10 min, followed by 50 cycles at 95°C for 15 s and 60°C for 1 min.

Primer and probe design

The following regions were amplified: exon A2 of the ABL housekeeping gene, as an endogenous control, and the junction BCR-ABL.

The follow primers and probes were used: i) Endogenous control ABL: cA2F (GGCCA GTAGCATCTGACTTTGA), cA2R (GTCCAGCGAGAAGGTTTTCCT) and cA2P (FAM-CCTCAGGGTCTGAGTGAAGCCGCTC-TAMRA). ii) Junction BCR-ABL: jB2F (TGACCA ACTCGTGTGTGAAACTC), jB3F (CCACTGGATTTAAGCAGAGTTCAA), jA2R (TCAGAC CCTGAGGCTCAAAGTC), and jA2P (VIC-AGCCCTTCAGCGGCCAGTAGCATC-TAMRA).

Measurement of BCR-ABL expression and interpretation

The quantification unit in the RQ-PCR is the cycle threshold (CT), which is the point in the cycle at which the log phase begins. This value was used to calculate the relative quantification. The measurement of BCR-ABL expression was defined as the ratio of BCR-ABL to ABL, according to the follow equation:

The quantification was thus defined as the number of copies of BCR-ABL per 10⁶ copies of ABL, which was transformed to a logarithm for analysis and interpretation.

Statistical analysis

The data were divided into two groups: paired samples and independent samples. Analysis of variance (ANOVA) was used for the comparison of BCR-ABL expression in paired samples between the following time points: DZ and 3M, DZ and 6M, and 3M and 6M. The Student t-test was used for the analyses of independent samples, which were compared at the time points DZ, 3M and 6M for the following characteristics: sex (female and male), age groups (£40 and older than 40 years), disease phase (chronic and accelerated/blastic), and transcripts (B2A2 and B3A2). In order to support the results of traditional statistical tests, bootstrapping was performed with 10,000 simulations for the t-test. P values <0.05 were considered significant.

RESULTS

The demographic and clinical characteristics of the 22 patients are shown in Table 1. All patients achieved complete hematological remission, and none of them underwent bone marrow aspiration for cytogenetic analysis.

Although mean BCR-ABL expression at the third month was slightly higher than on day zero, there was a significant decrease at six months (P = 0.0002), as shown in Figure 1. Most (73%) of the patients had a decreased expression of BCR-ABL, with a mean reduction of 1.73 log corresponding to approximately 80%; only 27% of the patients had an increased expression of BCR-ABL, with a mean of 1.67 log (Table 2).

Mean BCR-ABL expression was compared between categories according to sex, age group and phase of the disease at all time points, and no significant differences were found (P > 0.05). The same analysis was done between the transcripts B2A2 and B3A2, and a statistically significant difference was found for the levels of expression of transcripts B2A2 and B3A2 at six months (Figure 2 and Table 3).

DISCUSSION

Cytogenetic analysis remains an essential tool in the diagnosis of clonal evolution, but this method has a low sensitivity. RQ-PCR is a relatively simple technique that could become the method of choice for patient monitoring. RQ-PCR is very sensitive and also less invasive than cytogenetic analysis, given the fact that it is performed in peripheral blood.

To our knowledge, this is the first report on the differential expression of distinct BCR-ABL transcripts during imatinib treatment for CML.

We found a significant reduction in the expression of BCR-ABL, between the third and the sixth month of treatment (P = 0.0002), a finding that confirms the efficacy of imatinib in CML. Seventy-three percent of the patients had decreased levels of expression of BCR-ABL, with a mean reduction of 80% (1.73 log) in such levels. In the International Randomized Study of Interferon and STI-571 (IRIS) trial, Hughes et al. (2003) found that a 3 log reduction in the BCR-ABL expression predicts complete cytogenetic remissions at 12 months, given the fact that 57% of patients with these remissions had such reductions. In the present study, none of the patients had a reduction as profound as 3 log, probably because of previous reductions induced by hydroxyurea and/or interferon, and also because the analyses were limited to the first 6 months of treatment. Wang et al. (2003) reported that a reduction of 50% in BCR-ABL expression correlates with complete cytogenetic remissions after 6 months. Therefore, among most of patients (73%) in whom such reductions were observed in our study, only one would have had a lower likelihood of achieving a complete cytogenetic remission.

We found increased expression of BCR-ABL transcripts after 6 months in 27% of our patients (Table 2). Three of these four patients had at least two-fold increases in BCR-ABL levels. This observation leads us to speculate that these patients may have had mutations in the kinase domain of BCR-ABL, with resistance to imatinib (Branford et al., 2004).

We believe that BCR-ABL expression should not be measured without discrimination of the various types of transcripts, since mutations and a differential kinetics between transcripts may influence response to imatinib. In this study, we found a slight difference in the mean expression of B2A2 and B3A2 transcripts at the sixth month of treatment (P = 0.0347). This significant difference was confirmed by bootstrapping (P = 0.0375).

The different BCR-ABL transcripts are undergoing active investigation for their roles as prognostic factors for survival and for their correlation with clinical aspects of CML. Some investigators believe such roles are still controversial (Rosas-Cabral et al., 2003), and others believe that the different transcripts have no prognostic value and no correlation with clinical characteristics (Udomsakdi-Auewarakul et al., 2000; Prejzner, 2002). However, it seems clear that B3A2 is associated with an increased platelet count, which indicates a possible influence of this transcript on thrombopoiesis (Shepherd et al., 1995; Melo, 1997; Perego et al., 2000), despite the lack of correlation with prognosis (Udomsakdi-Auewarakul et al., 2000).

There is no current indication that the different transcripts are associated with specific clinical features of CML. Nevertheless, our study raises the hypothesis that the natural history of CML may be modified during treatment with imatinib, given that the reduction in BCR-ABL levels may occur preferentially with the B2A2 transcript; this preferential reduction occurred in spite of the similar levels of expression of B2A2 and B3A2 at the beginning of treatment (P = 0.5291). Thus, we believe that patients who express B2A2 should be studied further, and possibly be considered a subgroup with a better response to imatinib than patients who express B3A2 (Figure 2).

In this regard, it is important to bear in mind that 7 to 10% of patients display co-expression of B2A2 and B3A2. It is unlikely that such co-expression is due to two independent chromosomal rearrangements, but rather to alternative splicing of a transcript that is originally of the B3A2 type (Avana-Trejo et al., 2002). Thus, not all patients with isolated expression of B2A2 may be considered potential candidates for response to imatinib, since B3A2 may be initially present at undetectable levels and increase during treatment, eventually replacing B2A2. In fact, a patient in our series seems to represent an example of this phenomenon: after 3 months of treatment, this patient appeared to be in complete molecular remission, but B3A2 was present at the sixth month.

Despite the hypothesis-generating character of our study, we believe that the main types of transcripts (B2A2 and B3A2) should be quantified in patients with CML who undergo treatment with imatinib. This quantification may predict the likelihood of achieving a cytogenetic response, since the presence of B2A2 seems to indicate a higher likelihood of response to imatinib. Our results notwithstanding, this hypothesis should be further investigated by the inclusion of larger numbers of patients.

ACKNOWLEDGMENTS

Research supported by the National Research Council (CNPq), Process No. 470821/01-9. We thank the Federal University of Pará, for the academic structure, the HEMOPA Foundation, for the physical structure of the laboratory, the Onco-Hematology Service of Hospital Ofir Loiola, for clinical collaboration, and Novartis Pharma Brazil, for support in the preparation of the manuscript.

REFERENCES

Amabile M, Giannini B, Testoni N, Montefusco V et al. (2001). Real-time quantification of different types of bcr-abl transcript in chronic myeloid leukemia. Haematologica 86: 252-259.

Arana-Trejo RM, Ruiz Sanchez E, Ignacio-Ibarra G, Baez de la Fuente E et al. (2002). BCR/ABL p210, p190 and p230 fusion genes in 250 Mexican patients with chronic myeloid leukaemia (CML). Clin. Lab. Haematol. 24: 145-150.

Barbany G, Hagberg A, Olsson-Strömberg U, Simonsson B et al. (2000). Manifold-assisted reverse transcription-PCR with real-time detection for measurement of the BCR-ABL fusion transcript in chronic myeloid leukemia patients. Clin. Chem. 46: 913-920.

Branford S, Rudzki Z, Parkinson I, Grigg A et al. (2004). Real-time quantitative PCR analysis can be used as a primary screen to identify patients with CML treated with imatinib who have BCR-ABL kinase domain mutations. Blood 104: 2926-2932.

Campanini F, Santucci MA, Pattachini L, Brusa G et al. (2001). Competitive polymerase chain reaction as a method to detect the amplification of bcr-abl gene of chronic myeloid leukemia. Haematologica 86: 167-173.

Deininger MW, Goldman JM and Melo JV (2000). The molecular biology of chronic myeloid leukemia. Blood 96: 3343-3356.

Druker BJ, Talpaz M, Resta DJ, Peng B et al. (1999). Clinical efficacy and safety of an ABL-specific tyrosine kinase inhibitor as targeted therapy for chronic myeloid leukemia. Blood 94: 368 (Abstract).

Druker BJ, Talpaz M, Resta DJ, Peng B et al. (2001). Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N. Engl. J. Med. 344: 1031-1037.

Hughes T and Branford S (2003). Molecular monitoring of chronic myeloid leukemia. Semin. Hematol. 40: 62-68.

Hughes TP, Kaeda J, Branford S, Rudzki Z et al. (2003). Frequency of major molecular responses to imatinib or interferon alpha plus cytarabine in newly diagnosed chronic myeloid leukemia. N. Engl. J. Med. 349: 1423-1432.

Jaffe ES, Harris NL, Stein H and Vardiman JW (2001). World Health Organization. Classification of tumours. Pathology and genetics of tumours of haematopoietic and lymphoid tissues. IARC Press, Lyon, France.

Meissner RV, Covas DT, Dias PMB, Job F et al. (1999). Analysis of mRNA transcripts in chronic myeloid leukemia patients. Genet. Mol. Biol. 22: 475-479.

Melo JV (1997). BCR-ABL gene variants. Bailliere’s Clin. Haematol. 10: 203-222.

Perego RA, Costantini M, Cornacchini G, Gargantini L et al. (2000). The possible influences of B2A2 and B3A2 BCR/ABL protein structure on thrombopoiesis in chronic myeloid leukaemia. Eur. J. Cancer 36: 1395-1401.

Prejzner W (2002). Relationship of the BCR gene breakpoint and the type of BCR/ABL transcript to clinical course, prognostic indexes and survival in patients with chronic myeloid leukemia. Med. Sci. Monit. 8: BR193-BR197.

Rosas-Cabral A, Martinez-Mancilla M, Ayala-Sanchez M, Vela-Ojeda J et al. (2003). Analysis of Bcr-abl type transcript and its relationship with platelet count in Mexican patients with chronic myeloid leukemia. Gac. Med. Mex. 139: 553-559.

Saffroy R, Lemoine A, Brézillon P, Frenoy N et al. (2000). Real-time quantitation of bcr-abl transcripts in haematological malignancies. Eur. J. Haematol. 65: 258-266.

Shepherd P, Suffolk R, Halsey J and Allan N (1995). Analysis of molecular breakpoint and m-RNA transcripts in a prospective randomized trial of interferon in chronic myeloid leukaemia: no correlation with clinical features, cytogenetic response, duration of chronic phase, or survival. Br. J. Haematol. 89: 546-554.

Stentoft J, Pallisgaard N, Kjeldsen E, Holm MS et al. (2001). Kinetics of BCR-ABL fusion transcript levels in chronic myeloid leukemia patients treated with STI571 measured by quantitative real-time polymerase chain reaction. Eur. J. Haematol. 67: 302-308.

Talpaz M, Silver RT, Druker BJ, Goldman JM et al. (2002). Imatinib induces durable hematologic and cytogenetic responses in patients with accelerated phase chronic myeloid leukemia: results of a phase 2 study. Blood 99: 1928-1937.

Udomsakdi-Auewarakul C, Pratya Y, Boonmoh S and Vatanavicharn S (2000). Detection of molecular variants of BCR-ABL gene in bone marrow and blood of patients with chronic myeloid leukemia by reverse-transcriptase polymerase chain reaction (RT-PCR). J. Med. Assoc. Thai. 83: 928-935.

Wang L, Pearson K, Ferguson JE and Clark RE (2003). The early molecular response to imatinib predicts cytogenetic and clinical outcome in chronic myeloid leukaemia. Br. J. Haematol. 120: 990-999.